View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_514 (Length: 212)
Name: NF9839A_low_514
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_514 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 26 - 202
Target Start/End: Original strand, 11311732 - 11311908
Alignment:
| Q |
26 |
caaagatcacaatggattttatcaagaggaaattctgaaattttattagaactttggaatggcaatttacaattttttcccatttgacaactaacacaaa |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11311732 |
caaagatcacaatggattttatcaagaggagattctgaaattttattagaactttggaatggcaatttacaactttttcccatttgacaactaacacaaa |
11311831 |
T |
 |
| Q |
126 |
caacaagttttgatacccattgtgtcacattgattttgtctttcaacaaagataatatcttgaaattttgatgtcca |
202 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11311832 |
caacaggttttgatacccattgtgttacattgattttgtctttcaacaaagataatatcttgaaatttggatgtcca |
11311908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University