View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_516 (Length: 211)
Name: NF9839A_low_516
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_516 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 23 - 196
Target Start/End: Complemental strand, 7404793 - 7404620
Alignment:
| Q |
23 |
tgcagtaccagagatatccacgataagaacagatggaggattcttcatggattggatttcagagcgaataaaaggaagagattcaatcattgttaaaaca |
122 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7404793 |
tgcagtaccaaagatatccacgataagaacagatggaggattcttcatagattggatttcagagcgaataaaaggaagagattcaatcattgttaaaaca |
7404694 |
T |
 |
| Q |
123 |
atttgtaatcctaaggatggattgtttgggtcaagtttgtcggagacatcgacaggaggtgttacaatgatgtc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7404693 |
atttgtaatcctaaggatggattgtttgggtcaagtttgtcggagacatcgacaggaggtgttacaatgatgtc |
7404620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University