View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_520 (Length: 210)
Name: NF9839A_low_520
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_520 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 16 - 210
Target Start/End: Original strand, 40866221 - 40866411
Alignment:
| Q |
16 |
aaaaatatgcctaacatatatagaaaagatcatcaaagtgcagaagggcctaactctttcaattacttgtgtgccaagccatgtacttcatattttcaat |
115 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40866221 |
aaaaatatgcctaacatagata----agatcatcaaagtgcagaagggcctaactcttccaattacttgtgtgccaagccatgtacttcatattttcaat |
40866316 |
T |
 |
| Q |
116 |
tcagtacaactcaaaatttgatttaacctacctgttaggtgagcaaaggtcaaatgactctgataattaaatgtctctgcttgtctatgttggct |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40866317 |
tcagtacaactcaaaatttgatttaacctacctgttaggtgagcaaaggtcaaatgactctgataattaaatgtctctgcttgtctatgttggct |
40866411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University