View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_532 (Length: 206)
Name: NF9839A_low_532
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_532 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 33 - 193
Target Start/End: Complemental strand, 52763520 - 52763360
Alignment:
| Q |
33 |
ccaccctaaagaaaacatctccgccgccaaaatccaacgattttcagccaactcaaacaactgcttaaacctatctctaagaggaatactaactaataaa |
132 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52763520 |
ccaccctaaataaaacatctccgccgctaaaatccaacgattttcagccaattcaaacaactgcttaaacctatctctaagaggaatactacctaataaa |
52763421 |
T |
 |
| Q |
133 |
ggatttgttcatacaaatgttttgagtccattaccaactacccttttttaatattattcga |
193 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
52763420 |
ggatttgttcatacagatgatttgagtccattaccaactacccttttttaattttcttcga |
52763360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University