View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_548 (Length: 202)
Name: NF9839A_low_548
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_548 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 8 - 202
Target Start/End: Original strand, 31421158 - 31421352
Alignment:
| Q |
8 |
tggtgttgtggtggtttcttcttcttctattggttcttttccttgatggtttcaatgttttcgatccggtcccgttttagtttgtcccaatctgttccag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31421158 |
tggtgttgtggtggtttcttcttcttctattggttcttttccttgagggtttcaatgttttcgatccggtcccgttttagtttgtcccgatctgttccag |
31421257 |
T |
|
| Q |
108 |
atctgactgctacgccgtacacggctgtctgctacgccggagacctctctctgttgctattcacgttttttggtggtggtgcggagcttgtggtg |
202 |
Q |
| |
|
|| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
31421258 |
atttgactgctacaccgtacacggctgtctgctacgccggagacctctctctgttgctattcacgttttttggtggtggtgcggtggttgtggtg |
31421352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University