View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_549 (Length: 202)
Name: NF9839A_low_549
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_549 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 23 - 202
Target Start/End: Original strand, 42682479 - 42682658
Alignment:
| Q |
23 |
acatcattgggctctctgaagttcaatctccaaacccagtactgtcaattcatttgactgtcaaattggattgttaagccaggttttcgttgcatgtccg |
122 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42682479 |
acatcattgtgctctctgaagttcaatctccaaacccagtactgtcaattcatttgactgtcaaattggattgttaagccaggttttcgttgcatgtcag |
42682578 |
T |
|
| Q |
123 |
gttttgttacttttctttctcaagctaatcccttttgttcactttttgctttctgcaaattgtgggtaatgcccagaact |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42682579 |
gttttgttacttttctttctcaagctaatcccttttgttcactttttgctttctgcaaattgtgggtaatgcccagaact |
42682658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University