View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_553 (Length: 201)
Name: NF9839A_low_553
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_553 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 23 - 180
Target Start/End: Original strand, 44882809 - 44882966
Alignment:
| Q |
23 |
attatactcgctgtgaagttctgttttgctgctggatgttgttgtctataggaaattgttttgaaacatctaatagtgctgctgcagcaggtgctggggt |
122 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44882809 |
attatacttgctgtgaagttctgttttgctgctggatgttgttgtctataggaaattgttttgaaacatctaatagtgctgctacagcaggtgctggggt |
44882908 |
T |
|
| Q |
123 |
catggattggtactgaggaggtgcatttgcatttgcaggctgctgttgtgtgtagtat |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44882909 |
catggattggtactgaggaggtgcatttgcatttgcgggctgctgttgtgtgtagtat |
44882966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 64 - 151
Target Start/End: Complemental strand, 8978469 - 8978382
Alignment:
| Q |
64 |
ttgtctataggaaattgttttgaaacatctaatagtgctgctgcagcaggtgctggggtcatggattggtactgaggaggtgcatttg |
151 |
Q |
| |
|
|||| |||||||||||||||||||| ||| | | || ||| ||||| ||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
8978469 |
ttgtatataggaaattgttttgaaaaatcggacattgttgcagcagcgactgctgtggtcatggattggtactgagaaggtgcatttg |
8978382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University