View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_554 (Length: 201)
Name: NF9839A_low_554
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_554 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 14 - 172
Target Start/End: Original strand, 12065122 - 12065279
Alignment:
| Q |
14 |
ttgcagagaattgtggtcaaatgcagccgatgcagacaaaattcaagaagaaagttgtcaacaaggttttaaaacgtggtcacgccacgatctttgatat |
113 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12065122 |
ttgcagagaatcgtggtcaa-tgcagccgatgcagacaaaattcaagaagaaagttgtcaacaaggttttaaaacgtggtcacgccacgatctttgatat |
12065220 |
T |
 |
| Q |
114 |
tgcagagaatcgtggtcagatgaagttgatgttctgaggctgatgtggcgtcaattgtg |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
12065221 |
tgcagagaatcgtggtcagatgaagttgatgttatgaggctgctgtggcgtcaattgtg |
12065279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University