View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_555 (Length: 201)
Name: NF9839A_low_555
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_555 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 22 - 193
Target Start/End: Original strand, 6715308 - 6715480
Alignment:
| Q |
22 |
gaagaagaagcagaagaaagatcctaaaa-catggaccaatgaaatgaatctgattctgaattgtgaaggcaccatattttcaccacaccgcacatagtt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6715308 |
gaagaagaagcagaagaaagatcctaaaaacatggaccaatgaaatgaatctgattctgaattgtgaaggcaccatattttcaccacaccgcacatagtt |
6715407 |
T |
 |
| Q |
121 |
taatattgattatgactcagcacacacaaagcagcatcttccatttgccactactccacgtgtgatgtccatc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6715408 |
taatattgattatgactcagcacacacaaagcagcatcttccatttgccactactccacgtgtgatgtccatc |
6715480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University