View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_63 (Length: 394)
Name: NF9839A_low_63
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_63 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 65 - 385
Target Start/End: Complemental strand, 41793303 - 41792983
Alignment:
| Q |
65 |
ctgtggctggagatgaggagaggattgtcgagatttctgacccgccccgccgtgatccggatggtagaatgccacggttttcgccggcgcaggcggcgtt |
164 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
41793303 |
ctgtggctggagatgaggagaggattatcgagatttctgacacgcgccgccgtgatccggatggtagaatgccacagttttcgccggcgcaggaggcgtt |
41793204 |
T |
 |
| Q |
165 |
gcttctcattcatgagaggctgttggagaacgatccggggtttgaggatgaggaggactacggcggcggaagaggtggtggtgggaagcgtgtttctagt |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41793203 |
gcttctcattcatgagaggctgttggagaacgatccggggtttgaggatgaggaggactacggcggcggaagaggtggtggtgggaagcgtgtttctagt |
41793104 |
T |
 |
| Q |
265 |
aggttggttgtttcgaaaatgcatgttgggtcattgctaggaaaaggtggaaaaataattgaacagatgagaattgagacaaagacacaaattaggattc |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41793103 |
aggttggttgtttcgaaaatgcatgttgggtcattgctaggaaaaggtggaaaaataattgaacagatgagaattgagacaaagacacaaattaggattc |
41793004 |
T |
 |
| Q |
365 |
ttccaagggattcgtatctac |
385 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
41793003 |
ttccaagggattcgtatctac |
41792983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University