View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_97 (Length: 356)
Name: NF9839A_low_97
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_97 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 51 - 318
Target Start/End: Original strand, 47552330 - 47552597
Alignment:
| Q |
51 |
gaatctgtgtgatttaatagtaaggcacgtgctgttatatatgagttgtgcgttgtacaaaaacaaaaatataagagttttttcttcttcttatgaacag |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47552330 |
gaatctgtgtgatttaatagtaaggcacgtgctgttatatatgagttgtgcgttgtacaaaaacaaaaatataagagttttatcttcttcttatgaacag |
47552429 |
T |
 |
| Q |
151 |
aaaaaatatgcgttagtgcgttggatgtcattgactgatgactcaatgctagctagtgcacacattcgctattttctatcttgaactcgatcgaacacat |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47552430 |
aaaaaatatgcgttagtgcgttggatgtcattgactgatgactcaatgctagctagtgcacacattcgctattttctatcttgaactcgatcgaacacat |
47552529 |
T |
 |
| Q |
251 |
atatcactggcttcatcgtattcatatgtatgcttcccctttttgctaaaaagtataggccattatct |
318 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47552530 |
atatcactggtttcatcgtattcatatgtatgcttcccctttttgctaaaaagtataggccattatct |
47552597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University