View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9841_low_5 (Length: 324)
Name: NF9841_low_5
Description: NF9841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9841_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 37 - 308
Target Start/End: Complemental strand, 15198227 - 15197958
Alignment:
| Q |
37 |
gatggcaacagggacacaagcatacggtgaatcatggtactgggacaaccgttacacaaacgaacctggtccttttgattggtaccaaaagtatattact |
136 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15198227 |
gatggcaacaggtacacaagcatacggtgaatcatggtactgggacaaccgttacacaaacgaacctggtccttttgattggtaccaaaagtatattact |
15198128 |
T |
 |
| Q |
137 |
ttgtctcctatcatcaatctctatgttcccaagaaccaatctatccttgttgttggttctggtaattcaggcaagtcaatccaaaaataccannnnnnnn |
236 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15198127 |
ttggctcctatcatcaatctctatgttcccaagaaccaatctatccttgttgttggttctggtaattcaggcaagtcaatccaaaaataccatttttctt |
15198028 |
T |
 |
| Q |
237 |
cttctcttagatctctcttatagtatgatatttaatgccaccccatttattctttttcatttgtgttcaata |
308 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15198027 |
ct--tcttagatctctcttatagtatgatatttaatgccaccccatttattctttttcatttgggttcaata |
15197958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University