View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9842_high_8 (Length: 355)
Name: NF9842_high_8
Description: NF9842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9842_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 54827484 - 54827711
Alignment:
| Q |
1 |
gtaaggaagaaaatatggcgggagtgcaaataagagacgaacatggaaacccaattcaactaactgatgaattgggtaacccagttaagttaactgacga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54827484 |
gtaaggaagaaaatatggcgggagtgcaaataagagacgaacatggaaacccaattcaactaactgatgaattgggtaacccagttaagttaactgacga |
54827583 |
T |
 |
| Q |
101 |
acatggaaaccctatccatctcaccggtgtagcaaccactaccacaactaataataatcctccaactgcagcaggttcaggttcaggttcaggttcagct |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
54827584 |
acatggaaacccgatccatctcaccggtgtagcaaccactaccacaactcataataatcctccaactgcag------------caggttcaggttcagct |
54827671 |
T |
 |
| Q |
201 |
ggttttggcacctatggtagcgttgcttacggtggcggtg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54827672 |
ggttttggcacctatggtagcgttgcttacggtggcggtg |
54827711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 270 - 355
Target Start/End: Original strand, 54827735 - 54827820
Alignment:
| Q |
270 |
gtggcagatcttttgtccaccgaaccaccacccggacagcagctccatcacactgaccaggtttcaagaggacttcgtcgctcctc |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54827735 |
gtggcagatcttttgtccaccgaaccaccacccggacagcagctccatcacactgaccaggtttcaagaggacttcgtcgctcctc |
54827820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University