View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9842_low_12 (Length: 309)
Name: NF9842_low_12
Description: NF9842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9842_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 20 - 296
Target Start/End: Complemental strand, 28399555 - 28399276
Alignment:
| Q |
20 |
tgccaagctgaggctcttcctcttcccagttcctactacaacggctgaagatttccctccacctcgacgacgtctgcatcaaaaggttacatttacaaaa |
119 |
Q |
| |
|
||||||| |||||||||||||||| || ||||||||| || | ||||||||||| |||||||||| |||||||| |||||| |||||||| ||||||||| |
|
|
| T |
28399555 |
tgccaagttgaggctcttcctcttgcctgttcctactccatcagctgaagatttacctccacctccacgacgtccgcatcagaaggttacctttacaaaa |
28399456 |
T |
|
| Q |
120 |
gatgagatgaaggaatttcaagaactaaatattgtgaatgatggattcgaaaagattttaaaatatgttatgaagtgtttttgaatttaattactaatat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28399455 |
gatgagatgaaggaatttcaagaactaaatattgtgaatgatggattcgaaaagattttaaaatatgttatgaagtgtttttgaatttaattactaatat |
28399356 |
T |
|
| Q |
220 |
gtatagattccgattgatt---aatatattggtatttttatgatggatttgtctttgattattctttcacttatgtatct |
296 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| ||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
28399355 |
gtatagattccgattgattaataatatattggtatttttatgatagatttgtctctgattattcttgcacttatgtatct |
28399276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University