View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9842_low_17 (Length: 237)
Name: NF9842_low_17
Description: NF9842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9842_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 26 - 213
Target Start/End: Original strand, 11153816 - 11154003
Alignment:
| Q |
26 |
gagtttggtgttgaaaaagagaagatactggtatgccagaaaaagctgtggcagccatccaactcaggatcaagatgacaaactcatgaaactgtgcagc |
125 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11153816 |
gagtttggtgttgaaaaagagaagatattggtatgccagaaaaagctgtggcagccatccaactcaggatcaagatgacaaactcatgaaactgtgcagc |
11153915 |
T |
|
| Q |
126 |
ggtaagaaagagcaggttatctagaaatcgtaattccagaagtagagaaacaaagggaaacgaattcagagccactcttaacaaaaag |
213 |
Q |
| |
|
||| ||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
11153916 |
ggtgagaaagagcggcgtatctagaaatcgtaattccagaagtagagaaacaaagggaaacgaattcggagccactctttacaaaaag |
11154003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 98
Target Start/End: Complemental strand, 14569471 - 14569399
Alignment:
| Q |
26 |
gagtttggtgttgaaaaagagaagatactggtatgccagaaaaagctgtggcagccatccaactcaggatcaa |
98 |
Q |
| |
|
|||| |||||| || ||||||||| || || ||||||| |||||| ||||| ||||||||||||| ||||||| |
|
|
| T |
14569471 |
gagtatggtgtcgagaaagagaaggtattgatatgccaaaaaaagttgtgggagccatccaactctggatcaa |
14569399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University