View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9842_low_18 (Length: 229)
Name: NF9842_low_18
Description: NF9842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9842_low_18 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 117 - 229
Target Start/End: Complemental strand, 54827949 - 54827841
Alignment:
| Q |
117 |
gactttcattatttcaaaggaataataaaccaaatccgtaagaatatactatacatgtctcatgcagtacttaattaataaaggaatagatcgaatagat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
54827949 |
gactttcattatttcaaaggaataataaaccaaatccgtaagaatatactatacatgtctcatgcagtaattaattaataaaggaata----gaatagat |
54827854 |
T |
 |
| Q |
217 |
atacttacagagc |
229 |
Q |
| |
|
||||||||||||| |
|
|
| T |
54827853 |
atacttacagagc |
54827841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University