View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9842_low_18 (Length: 229)

Name: NF9842_low_18
Description: NF9842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9842_low_18
NF9842_low_18
[»] chr3 (1 HSPs)
chr3 (117-229)||(54827841-54827949)


Alignment Details
Target: chr3 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 117 - 229
Target Start/End: Complemental strand, 54827949 - 54827841
Alignment:
117 gactttcattatttcaaaggaataataaaccaaatccgtaagaatatactatacatgtctcatgcagtacttaattaataaaggaatagatcgaatagat 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    ||||||||    
54827949 gactttcattatttcaaaggaataataaaccaaatccgtaagaatatactatacatgtctcatgcagtaattaattaataaaggaata----gaatagat 54827854  T
217 atacttacagagc 229  Q
    |||||||||||||    
54827853 atacttacagagc 54827841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University