View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9842_low_6 (Length: 394)
Name: NF9842_low_6
Description: NF9842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9842_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 17 - 384
Target Start/End: Original strand, 4513549 - 4513917
Alignment:
| Q |
17 |
acatataactacctcttagctctgacttaaatttccattcaatggaacagctgaagctttggcttcacaggttactcaagagcattatgacaggggactc |
116 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4513549 |
acatataactacctctgagctctgacttaaatttccattcaatggaacagctgaagctttggcttcacaggttactcaagagcattatgacaggggactc |
4513648 |
T |
 |
| Q |
117 |
atatacccgcctttcactaacatcagaaagatttcggcacacattgccgccaaagtggcaactaaggcttatgagcttggtgagcgttagttttcctttt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4513649 |
atatacccgcctttcactaacatcagaaagatttcggcacacattgccgccaaagtggcaactaaggcttatgagcttggtgagcgttagttttcgtttt |
4513748 |
T |
 |
| Q |
217 |
ggttaaaaatttcannnnnnnnatgtttggctaaatatgtttttagtccttaaactgtggtaatttttgcttttggtccccca-nnnnnnnactcgtctt |
315 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
4513749 |
ggttaaaaatttcattttttttatgtttggctaaatatgtttttagtccttaaactgtggtaatttttgcttttggccccccattttttttactcgtctt |
4513848 |
T |
 |
| Q |
316 |
gtcacttcatttcttaaaatacatcgacatttctctttacaattatttccgctggtcagacaacctatg |
384 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4513849 |
gtcacttcatttcttaaaatgcatcgacatttctctttacaattatttctgctggtcagacaacctatg |
4513917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 129 - 197
Target Start/End: Complemental strand, 43431791 - 43431723
Alignment:
| Q |
129 |
ttcactaacatcagaaagatttcggcacacattgccgccaaagtggcaactaaggcttatgagcttggt |
197 |
Q |
| |
|
||||| |||||||||||||| || || ||||| || |||||||| || |||||||||||||||||||| |
|
|
| T |
43431791 |
ttcaccaacatcagaaagatatcagctcacatagctgccaaagttgctgctaaggcttatgagcttggt |
43431723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University