View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9845_high_21 (Length: 204)
Name: NF9845_high_21
Description: NF9845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9845_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 39183479 - 39183285
Alignment:
| Q |
1 |
cgagtaatgataaaattaaaacatactctgattgttcacaaaatattttaacatatctttgtttattataactcatcacttaaatttccatatgaatgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39183479 |
cgagtaatgataaaattaaaacatactctgattgttcacaaaatattttaacatatcttcgtttattataactcatcacttaaatttccatatgaatgaa |
39183380 |
T |
 |
| Q |
101 |
atgaacgatgataaaattaaaacatactccgattgttcacaaaatattattacaggatgatttgaaattctaattgcttatgtgttttcctatgc |
195 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39183379 |
atgaatgatgataaaattaaaacatactccgattgttcacaaaatattattacaggatgatttgaaattctaattgcttatgtgttttcctatgc |
39183285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 73 - 148
Target Start/End: Complemental strand, 39183508 - 39183433
Alignment:
| Q |
73 |
tcatcacttaaatttccatatgaatgaaatgaacgatgataaaattaaaacatactccgattgttcacaaaatatt |
148 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39183508 |
tcatcacttaaatttccatatgaatgaaacgagtaatgataaaattaaaacatactctgattgttcacaaaatatt |
39183433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University