View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9845_low_11 (Length: 425)
Name: NF9845_low_11
Description: NF9845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9845_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 249; Significance: 1e-138; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 277
Target Start/End: Original strand, 24505681 - 24505956
Alignment:
| Q |
1 |
gatagcttgagttttccaaatttggatagccttgtaaccacttttaacccgtatagtttccgttcggttcatgcatccacatgagggtatcctccttatt |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24505681 |
gatagcttgagttttccaaacttggatagccttgtaaccacttttaacc-gtatagtttccgttcggttcatgcatccacatgagggtatcctccttatt |
24505779 |
T |
|
| Q |
101 |
agtgtttatcaggggaattttctcaatggtggccctgaccaggggaataaataaagaacctaaaatctccttgttccaactagaagtttcgctgtgaatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24505780 |
agtgtttatcaggggaattttctcaatggtggccctgtccaggggaataaataaagaacctaaaatctccttgttccaactagaagtttcgctgtgaatt |
24505879 |
T |
|
| Q |
201 |
aagtctttaacaaatctgtagttagaatagtttgtagtctgaatcaggaccttgaaattgtggtgggaagggagcca |
277 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
24505880 |
aagtctttaacaaatctgcagttagaatagtttgtagtctgaatcaggaccttgtaattgtggtgggatgggagcca |
24505956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 273 - 411
Target Start/End: Original strand, 24505983 - 24506121
Alignment:
| Q |
273 |
agccattccctatgcgctagcaactacctttttggattatctaaatagattgttggatgctcctccaagcaaagcttggactatttccaatgggagcatg |
372 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24505983 |
agccattccctatgcgctagcaactacctttttggattatctaaatagattgttggatgctcctccaagcaaagcttggactatttccaatgggagcatg |
24506082 |
T |
|
| Q |
373 |
tagaatatccgtattgggaaagtattcggccttgtaact |
411 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24506083 |
tagaatatccgtattgggaaagtattcggccttgtaact |
24506121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University