View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9845_low_13 (Length: 419)
Name: NF9845_low_13
Description: NF9845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9845_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 250; Significance: 1e-139; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 279
Target Start/End: Complemental strand, 32258319 - 32258039
Alignment:
| Q |
1 |
tatgggataaacaagttaaattgtttcagcttgcagatattctgatatgaatatgaaactctct--gaattataagttcagagcaaaacataaagtacaa |
98 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32258319 |
tatggggtaaactagttaaattgtttcagcttgcagatattctgatatgaatatgaaactctctctgaattataagttcagagcaaaacataaagtacaa |
32258220 |
T |
|
| Q |
99 |
tgctttatagaagcaatggataattctatactgcttgcttaataatctttgctatattctacctagcggactcagtatgtatgtttaatctagtttactc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
32258219 |
tgctttatagaagcaatggataattctatactgcttgcttaataatctttgctatattctacctagcggattcagtatgtatgtttaatctattttactc |
32258120 |
T |
|
| Q |
199 |
gttagagattttataatctgaaatgtatttaacggtttttgtattataaaattggaaatatatatttttcccttttgctag |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32258119 |
gttagagattttataatctgaaatgtatttaacggtttttgtattataaaattggaaatatatatttttcctttttgctag |
32258039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 311 - 395
Target Start/End: Complemental strand, 32257994 - 32257900
Alignment:
| Q |
311 |
cctaaatcggattatataatttggagtgtggtttcccgtttcc----------aatccgaaatactcatatatatacatggacggatgcatgtag |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32257994 |
cctaaatcggattatataatttggagtgtggtttcccgtttcggattatatataatccgaaatactcatatatatacatggacggatgcatgtag |
32257900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University