View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9845_low_24 (Length: 272)
Name: NF9845_low_24
Description: NF9845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9845_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 13 - 256
Target Start/End: Original strand, 14510271 - 14510514
Alignment:
| Q |
13 |
aaggttagaatgaatcgtatcttagaaggacaccgtaaagtcctctttatagactagggagcaaggatccatgaagttaaggctaaagagttgttggtgt |
112 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| || |||||||||||||||||||||||| ||||| | |||||||||||| | |||||||||| |
|
|
| T |
14510271 |
aaggttagaatgaatcgtatcttaggaggacaccgtagagccctctttatagactagggagcaagaatccaaggtgttaaggctaaaaaattgttggtgt |
14510370 |
T |
 |
| Q |
113 |
gcggttacaaacggcggagttttgtaaccgtcatctattggtctttatcgcggacatgagatgttatgaatttggggaaacctaaaccactatccattgg |
212 |
Q |
| |
|
||||||||||| || |||||||||||||||| |||||||||||||||||||||||||||||||||| | || |||||| |||||||| ||||||||||| |
|
|
| T |
14510371 |
gcggttacaaatggaggagttttgtaaccgttatctattggtctttatcgcggacatgagatgttaaggatgcggggaatcctaaacccctatccattgg |
14510470 |
T |
 |
| Q |
213 |
agtttttgtttggcgtatctttgaagcggaattggtgtggatgg |
256 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
14510471 |
agtttttgtttggtgtatctttgaagtagaattggtgtggatgg |
14510514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University