View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9845_low_29 (Length: 255)
Name: NF9845_low_29
Description: NF9845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9845_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 166 - 241
Target Start/End: Original strand, 22182143 - 22182218
Alignment:
| Q |
166 |
cggcgtgagttgatgaagatgaaacgatgattagaggaagcagtggttatacggtggttgtgagtgggaggaagtg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22182143 |
cggcgtgagttgatgaagatgaaacgatgatgagaggaagcagtggttatacggtggttgtgagtgggaggaagtg |
22182218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 7 - 54
Target Start/End: Original strand, 22181965 - 22182012
Alignment:
| Q |
7 |
gcattgaattcacctataacactagtgcgaatttgagtgagtcgcatt |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22181965 |
gcattgaattcacctataacactagtgcgaatttgagtgagtcgcatt |
22182012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University