View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9845_low_30 (Length: 253)
Name: NF9845_low_30
Description: NF9845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9845_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 19070678 - 19070483
Alignment:
| Q |
1 |
ttcgcctttcaaccgattaacaggctttaatgcattctggtactcacaccatcttcttggtattgtctacattcttttggtcatccatggatcgttcttg |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |||| ||||||||||||||| |
|
|
| T |
19070678 |
ttcgcctttcaacagattaacaggctttaatgcattctggtactcacatcatcttcttggtattgtctacattcttctgttcattcatggatcgttcttg |
19070579 |
T |
|
| Q |
101 |
aatttgacgcataaatggtaccagaaaacggtaagaactttgaccataatattcgtcggtatgagaaaagtgaatgatgagtaaagtataccaaca |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19070578 |
aatttgacgcataaatggtaccagaaaacggtaagaacttcgaccataatattcgtcggtatgagaaaagtgaatgatgagtaaagtatactaaca |
19070483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University