View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9845_low_36 (Length: 242)
Name: NF9845_low_36
Description: NF9845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9845_low_36 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 17 - 242
Target Start/End: Complemental strand, 19070986 - 19070760
Alignment:
| Q |
17 |
attattatcatgtccttatt-gattttatctctactttctatccatttctacagatgattgcatttgccatagttgtgggaatacttgttcatgcaggaa |
115 |
Q |
| |
|
||||| |||||||||||||| |||||| |||||||| ||| || ||||| |||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
19070986 |
attatgatcatgtccttatttgattttgtctctactatctttctatttcaacagatgattgcattttccatagtagtgggaatacttgttcatgcaggaa |
19070887 |
T |
|
| Q |
116 |
atcacatctcatgcgatttccctctactcgtaaactcatctctagaaaaattctcactgatagcttctgatttcaataacaaaaagcccacatacaaatc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19070886 |
atcacatctcatgcgatttccctctactcgtaaactcgtctccagaaaagttctcactgatagcttctgatttcaacaacaaaaagcccacatacaaatc |
19070787 |
T |
|
| Q |
216 |
acttttcattagcattgaaggtgtaac |
242 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
19070786 |
acttttcattagcattgaaggtgtaac |
19070760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University