View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9845_low_37 (Length: 242)
Name: NF9845_low_37
Description: NF9845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9845_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 36863805 - 36864024
Alignment:
| Q |
1 |
atggtcgtgtggagtgatactttacataatgctagtgggagaatttccatttggggaccaaaaggatctgcaaaatctcaagaaaatcatgaatgtactt |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36863805 |
atggtcgtgtggagtgatactttaaataatgctagtgggagaatttccatttggggaccaaaaggatctgcacaatctcaagaaaatcatgaatgtactt |
36863904 |
T |
 |
| Q |
101 |
aattttccttcnnnnnnnnnnccaaccctagtaaatagatttatcacatgactattcttactagtgatgcaacnnnnnnngcagaaaattatgcttgttc |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
36863905 |
aattttccttc---tttttttccaaccctagtaaatagatttatcacatgactattcttactggtgatgcaactttttttgcagaaaattatgcttgttc |
36864001 |
T |
 |
| Q |
201 |
aatacaagatcccaaacaccgtt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
36864002 |
aatacaagatcccaaacaccgtt |
36864024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University