View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9847_high_10 (Length: 282)

Name: NF9847_high_10
Description: NF9847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9847_high_10
NF9847_high_10
[»] chr1 (2 HSPs)
chr1 (146-271)||(7560685-7560810)
chr1 (19-48)||(7560906-7560935)


Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 146 - 271
Target Start/End: Complemental strand, 7560810 - 7560685
Alignment:
146 tagtatttgaatctatgtaatgcaggagcgcacgatgagagataactgtttagtttaaattcattatggtcctctaattccaagatgcagaccaatgagc 245  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7560810 tagtatttgaatctatgtaatgcaggaacgcacgatgagagataactgtttagtttaaattcattatggtcctctaattccaagatgcagaccaatgagc 7560711  T
246 gacgattcattttccatttcgtctct 271  Q
    ||||||||||||||||||||||||||    
7560710 gacgattcattttccatttcgtctct 7560685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 48
Target Start/End: Complemental strand, 7560935 - 7560906
Alignment:
19 attggttggatctataacttggtttcttat 48  Q
    ||||||||||||||||||||||||||||||    
7560935 attggttggatctataacttggtttcttat 7560906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University