View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9847_high_16 (Length: 239)
Name: NF9847_high_16
Description: NF9847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9847_high_16 |
 |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 68 - 223
Target Start/End: Complemental strand, 31034356 - 31034201
Alignment:
| Q |
68 |
ttgttccgtaaaaagtggcagtttttgcttggcgggctatacgaaatcagtagtgaggaatcaggatgtatatcgcatttattttttgagtgttctgnnn |
167 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31034356 |
ttgttccataaaaagtggcagtttttgcttggcgggctatacgaaatcagtactgaggaatcaggatgtatatcgcatttattttttgagtgttctgttt |
31034257 |
T |
 |
| Q |
168 |
nnnnnnataagacatggttggatttaaccgattggatggggattaaagtagtatac |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31034256 |
ttttttataagacatggttggatttaaccgattggatggggattaaagtagtatac |
31034201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 38 - 223
Target Start/End: Original strand, 30617 - 30802
Alignment:
| Q |
38 |
tactcatgaatcaggatgtatgtcgtggttttgttccgtaaaaagtggcagtttttgcttggcgggctatacgaaatcagtagtgaggaatcaggatgta |
137 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| ||||| ||| | | ||||||||||||| |
|
|
| T |
30617 |
tactcaggaatcaggatgtatgtcgtgattttgttccgtaaaaagtggcagtttttggctggcgggctatacaaaatcggtactcatgaatcaggatgta |
30716 |
T |
 |
| Q |
138 |
tatcgcatttattttttgagtgttctgnnnnnnnnnataagacatggttggatttaaccgattggatggggattaaagtagtatac |
223 |
Q |
| |
|
||| ||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30717 |
tattgcatttattttttgagtgttctgtttttttttataagacatggttggatttgaccgattggatggggattaaagtagtatac |
30802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 30500 - 30637
Alignment:
| Q |
1 |
acatactggttttgtcttatattaagataaatttcattactcatgaatcaggatgtatgtcgtggttttgttccgtaaaaagtggcagtttttgcttggc |
100 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||| ||||||| |||||| ||||||||||||||||||||||| |||||||||||||||||||||| || |
|
|
| T |
30500 |
acatactggttttgtcctatattaagctaaatttctttactcaggaatcaagatgtatgtcgtggttttgttccataaaaagtggcagtttttgcttagc |
30599 |
T |
 |
| Q |
101 |
gggctatacgaaatcagtagtgaggaatcaggatgtat |
138 |
Q |
| |
|
||||||||| ||||||||| | |||||||||||||||| |
|
|
| T |
30600 |
gggctatacaaaatcagtactcaggaatcaggatgtat |
30637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University