View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9847_low_14 (Length: 336)
Name: NF9847_low_14
Description: NF9847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9847_low_14 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 18 - 336
Target Start/End: Complemental strand, 2097680 - 2097362
Alignment:
| Q |
18 |
catatcactattgaaaccttgtttccaatctcactcatgtacggtcttacatgtgctgtgtccttcgcagcattgacaatcattttaccaaacattgttg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2097680 |
catatcactattgaaaccttgtttccaatctcactcatgtacggtcttacatgtgctgtgtccttcgcagcgttgacaatcattttaccaaacattgttg |
2097581 |
T |
|
| Q |
118 |
ctatactcaatttgaccttatggctcattgttttctttgttattctttacattaactatcaaaatcaaaacctatttgtagctgcacctcgtgacgagga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2097580 |
ctatactcaatttgaccttatggctcattgttttctttgttattctttacattaactatcaaaatcaaaacctatttgtagctgcacctcgtgacgagga |
2097481 |
T |
|
| Q |
218 |
agctgcaactcttgccgaggcagtggcatctggcagcaagctggaagtagaagtaggtttacagaagtttgatgtcaatgggagcagccgtgagctgggt |
317 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2097480 |
agctgcaactcttgccgaggtagtggcatctggcagcaagctggaagtagaagtaggtttacagaagtttgatgtcaatgggagcagccgtgacctgggt |
2097381 |
T |
|
| Q |
318 |
tggatcagcgacccaggct |
336 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
2097380 |
tggatcagcgacccaggct |
2097362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University