View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9847_low_17 (Length: 282)
Name: NF9847_low_17
Description: NF9847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9847_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 146 - 271
Target Start/End: Complemental strand, 7560810 - 7560685
Alignment:
| Q |
146 |
tagtatttgaatctatgtaatgcaggagcgcacgatgagagataactgtttagtttaaattcattatggtcctctaattccaagatgcagaccaatgagc |
245 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7560810 |
tagtatttgaatctatgtaatgcaggaacgcacgatgagagataactgtttagtttaaattcattatggtcctctaattccaagatgcagaccaatgagc |
7560711 |
T |
 |
| Q |
246 |
gacgattcattttccatttcgtctct |
271 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
7560710 |
gacgattcattttccatttcgtctct |
7560685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 48
Target Start/End: Complemental strand, 7560935 - 7560906
Alignment:
| Q |
19 |
attggttggatctataacttggtttcttat |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7560935 |
attggttggatctataacttggtttcttat |
7560906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University