View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9847_low_21 (Length: 266)
Name: NF9847_low_21
Description: NF9847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9847_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 125 - 253
Target Start/End: Complemental strand, 52132782 - 52132657
Alignment:
| Q |
125 |
aattagactttcgcaaaatttattgaaaatttatcctaattaaaaattaaatatttcatcgacgtcaattttctctataattaccagtataaacgacgag |
224 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| || || |||||| |||||||||||||| |
|
|
| T |
52132782 |
aattaaactttcgcaaaatttattgaaaatttatcctaat---aaattaaatatttcatggacgtcaattttatcgatgattacctgtataaacgacgag |
52132686 |
T |
|
| Q |
225 |
ttctcatacatatatcatcattatataca |
253 |
Q |
| |
|
| |||| ||||||||||||||||||||| |
|
|
| T |
52132685 |
ctttcatgcatatatcatcattatataca |
52132657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 52133064 - 52132979
Alignment:
| Q |
1 |
attttgctagatgctttctacttcattcggaatgattaattttccttaaatgtggttgttagtgtattgttcttatccttacttca |
86 |
Q |
| |
|
|||||| | |||| ||||| |||||||||||| |||| ||||| ||||||||||||| || ||| ||||||||||| |||||||| |
|
|
| T |
52133064 |
attttgttcgatggtttctgcttcattcggaaggatttattttgcttaaatgtggttcctactgtgttgttcttatctttacttca |
52132979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University