View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9847_low_26 (Length: 244)
Name: NF9847_low_26
Description: NF9847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9847_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 9 - 229
Target Start/End: Original strand, 38719269 - 38719489
Alignment:
| Q |
9 |
agaagaaaaaattgctacaccaaaatttggtaacccctacgtatattctttaataagagacgtgttttctctttaaaacttctggtaaatgctgttcaac |
108 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38719269 |
agaagaaaaaatggctacaccaaaatttggtaacccctacgtatattctttaataagagacgtgttttctctttaaaacttctggtaaatgctgttcaac |
38719368 |
T |
 |
| Q |
109 |
tatagacagaaagaaatacctatgaatataattgattactaactgacactttttgtttgcagcatggagtggatgttaatgcaatggataggactctgct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38719369 |
tatagacagaaagaaatacctatgaatataattgattactaaatgacactttttgtttgcagcatggagtggatgttaatgcaatggataggactctgct |
38719468 |
T |
 |
| Q |
209 |
tcaatcttcaaagccatttct |
229 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
38719469 |
tcaatcttcaaagccatttct |
38719489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University