View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9847_low_30 (Length: 224)
Name: NF9847_low_30
Description: NF9847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9847_low_30 |
 |  |
|
| [»] scaffold0411 (1 HSPs) |
 |  |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
| [»] scaffold0004 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
| [»] scaffold0073 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 50 - 204
Target Start/End: Original strand, 41495478 - 41495632
Alignment:
| Q |
50 |
atatagaagactatgaaaatcttattttgactttatataaaacaaaatattgtgtttcggtgtaaaatttctttttaattttggtcttgacttcattata |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41495478 |
atatagaagactatgaaaatcttattttgactttatataaaacaaaatattgtgtttcggtgtaaaaattctttttaattttggtcttgacttcattata |
41495577 |
T |
 |
| Q |
150 |
ttttacaacttaatccttccttgctaataaaagtggaaaaaatgtgtccgccctt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41495578 |
ttttacaacttaatccttccttgctaataaaagtggaaaaaatgtgtccgccctt |
41495632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 41495398 - 41495435
Alignment:
| Q |
1 |
atattcaattgacaattttaataccttattatcatcaa |
38 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41495398 |
atattcaattgacaattttaataccttgttatcatcaa |
41495435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 6 - 38
Target Start/End: Complemental strand, 7794208 - 7794176
Alignment:
| Q |
6 |
caattgacaattttaataccttattatcatcaa |
38 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
7794208 |
caattgacaattttaataccttgttatcatcaa |
7794176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 6 - 38
Target Start/End: Complemental strand, 7804164 - 7804132
Alignment:
| Q |
6 |
caattgacaattttaataccttattatcatcaa |
38 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
7804164 |
caattgacaattttaataccttgttatcatcaa |
7804132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 13303242 - 13303279
Alignment:
| Q |
1 |
atattcaattgacaattttaataccttattatcatcaa |
38 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13303242 |
atatccaattgacaattttaataccttattatcatcaa |
13303279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 10882910 - 10882873
Alignment:
| Q |
1 |
atattcaattgacaattttaataccttattatcatcaa |
38 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
10882910 |
atatccaattgacaattttaataccttgttatcatcaa |
10882873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 14304120 - 14304083
Alignment:
| Q |
1 |
atattcaattgacaattttaataccttattatcatcaa |
38 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
14304120 |
atattcaattgacatttttaataccttgttatcatcaa |
14304083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 16412441 - 16412478
Alignment:
| Q |
1 |
atattcaattgacaattttaataccttattatcatcaa |
38 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
16412441 |
atattcaattgatatttttaataccttattatcatcaa |
16412478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 31800563 - 31800525
Alignment:
| Q |
1 |
atattcaattgacaatttt-aataccttattatcatcaa |
38 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31800563 |
atattcaattgacaatttttaataccttattatcatcaa |
31800525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 45086816 - 45086778
Alignment:
| Q |
1 |
atattcaattgacaatttt-aataccttattatcatcaa |
38 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45086816 |
atattcaattgacaatttttaataccttattatcatcaa |
45086778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0411 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0411
Description:
Target: scaffold0411; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 12635 - 12672
Alignment:
| Q |
1 |
atattcaattgacaattttaataccttattatcatcaa |
38 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
12635 |
atatccaattgacaattttaataccttgttatcatcaa |
12672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 59958 - 59995
Alignment:
| Q |
1 |
atattcaattgacaattttaataccttattatcatcaa |
38 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
59958 |
atattcaattgacatttttaataccttgttatcatcaa |
59995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 220660 - 220697
Alignment:
| Q |
1 |
atattcaattgacaattttaataccttattatcatcaa |
38 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
220660 |
atatccaattgacaattttaataccttgttatcatcaa |
220697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 1153 - 1190
Alignment:
| Q |
1 |
atattcaattgacaattttaataccttattatcatcaa |
38 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
1153 |
atattcaattgatatttttaataccttattatcatcaa |
1190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 19156599 - 19156636
Alignment:
| Q |
1 |
atattcaattgacaattttaataccttattatcatcaa |
38 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
19156599 |
atatccaattgacaattttaataccttgttatcatcaa |
19156636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 20255302 - 20255265
Alignment:
| Q |
1 |
atattcaattgacaattttaataccttattatcatcaa |
38 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
20255302 |
atatccaattgacaattttaataccttgttatcatcaa |
20255265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 13602580 - 13602617
Alignment:
| Q |
1 |
atattcaattgacaattttaataccttattatcatcaa |
38 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
13602580 |
atatccaattgacaattttaataccttgttatcatcaa |
13602617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 22019772 - 22019809
Alignment:
| Q |
1 |
atattcaattgacaattttaataccttattatcatcaa |
38 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
22019772 |
atatccaattgacaattttaataccttgttatcatcaa |
22019809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0073 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0073
Description:
Target: scaffold0073; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 6 - 38
Target Start/End: Original strand, 58901 - 58933
Alignment:
| Q |
6 |
caattgacaattttaataccttattatcatcaa |
38 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
58901 |
caattgacaattttaataccttgttatcatcaa |
58933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University