View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9847_low_32 (Length: 209)
Name: NF9847_low_32
Description: NF9847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9847_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 19 - 195
Target Start/End: Complemental strand, 21550530 - 21550354
Alignment:
| Q |
19 |
gtattggtggaatggtgaaaagttttgggggttaaaccctagcaaaatacaagcctacaaaaatatacgaagcaaatatttaatttatgattattgtgct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21550530 |
gtattggtggaatggtgaaaagttttgggggttaaaccctaggaaaatacaagcctacaaaaatatacgaagcaaatatttaatttatgattattgtgct |
21550431 |
T |
|
| Q |
119 |
aaacagccacaaattcctgagtgtcaaaatttacctatatactaaatctacttgtgagagtattgtatggaataagt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21550430 |
aaacagccacaaattcctgagtgtcaaaatttacctatatactaaatctacttgtgagagtattgtatggaataagt |
21550354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 68 - 185
Target Start/End: Original strand, 21656901 - 21657018
Alignment:
| Q |
68 |
caagcctacaaaaatatacgaagcaaatatttaatttatgattattgtgctaaacagccacaaattcctgagtgtcaaaatttacctatatactaaatct |
167 |
Q |
| |
|
||||| ||||| ||| | |||||||| |||||||| |||||||||||| ||||||||||| ||| || |||||||||| ||||| | || ||||| ||| |
|
|
| T |
21656901 |
caagcttacaataatgtgcgaagcaagtatttaatatatgattattgtactaaacagccagaaaatcttgagtgtcaaggtttacatctaaactaattct |
21657000 |
T |
|
| Q |
168 |
acttgtgagagtattgta |
185 |
Q |
| |
|
| |||||||| |||||| |
|
|
| T |
21657001 |
agatgtgagagaattgta |
21657018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University