View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9847_low_33 (Length: 202)
Name: NF9847_low_33
Description: NF9847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9847_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 18 - 185
Target Start/End: Complemental strand, 35802194 - 35802022
Alignment:
| Q |
18 |
cgtgttggtgattgatggttatgataaccttttttatgctgctgtggttgctgtttattcagcattggaaaaagtaggtggaaggtcatttaacttagtt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35802194 |
cgtgttggtgattgatggttatgataaccttttttatgctgttgtggatgctgtttattcagcattggaaaaagtaggtggaaggtcatttaacttagtt |
35802095 |
T |
|
| Q |
118 |
gtataa-----gagagtggttggccttcatctgacgggacagtaacttcacctgataatgcaatgctagaact |
185 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35802094 |
gtataagagaagagagtggttggccttcatctgacgggacagtaacttcacctgataatgcaatgctagaact |
35802022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 77 - 176
Target Start/End: Complemental strand, 35765525 - 35765423
Alignment:
| Q |
77 |
cagcattggaaaaagtaggtggaaggtcatttaacttagttgtata---agagagtggttggccttcatctgacgggacagtaacttcacctgataatgc |
173 |
Q |
| |
|
|||||||||| ||||||||| | |||| || ||| |||||||||| | | |||||||| ||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
35765525 |
cagcattggagcaagtaggtgtagggtctttgaacatagttgtatattaacatagtggttgctcttcatctggtgggacagtaacttcacttgataatgc |
35765426 |
T |
|
| Q |
174 |
aat |
176 |
Q |
| |
|
||| |
|
|
| T |
35765425 |
aat |
35765423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University