View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9847_low_6 (Length: 403)
Name: NF9847_low_6
Description: NF9847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9847_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 299; Significance: 1e-168; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 11 - 386
Target Start/End: Original strand, 28594714 - 28595086
Alignment:
| Q |
11 |
tgttgtttagtagtaaggtttctatcatatgatatgattatttaactannnnnnn-ctttcaaatttggctgcccattatagattatttcttaatatttc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28594714 |
tgttgtttagtagtaaggtttctatcatatgatatgattatttaactattttttttctttcaaatttggctgcccatgatagattatttcttaatatttc |
28594813 |
T |
 |
| Q |
110 |
aattttcattggtgtagcttagtggagatttatttatgataaaccttgaaccgaacccttccccattatagttaatgtttatggattatttgtgatataa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28594814 |
aattttcattggtgtagcttagtggagatttatttatgataaaccttgaaccgaaccctgccccattatagttaatgtttatggattatttgtgatataa |
28594913 |
T |
 |
| Q |
210 |
tgttggttttcttggtgagaaaaaaggggtgggtgagtgtgcagtaaaaattgcttttatagtgtatcatggctggtgatagcaaacaaaccatccataa |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28594914 |
tgttggttttcttggtgagaaaaaaggggtgggtgagtgtgcagtaaaaattgcttttatagtgtatcatggctggtgatag----caaaccatccataa |
28595009 |
T |
 |
| Q |
310 |
ttaaataaacgaacgaactttctatnnnnnnnntctttcaagtggaaatttcggatgaaggaaatcaccattcacac |
386 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28595010 |
ttaaataaacgaacgaactttctatacaaaaaatctttcaagtggaaatttcggatgaaggaaatcaccattcacac |
28595086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 343 - 386
Target Start/End: Complemental strand, 30256580 - 30256537
Alignment:
| Q |
343 |
tctttcaagtggaaatttcggatgaaggaaatcaccattcacac |
386 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30256580 |
tctttcaagtggaaatttcagatgaaggaaatcaccattcacac |
30256537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University