View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9848_low_11 (Length: 310)
Name: NF9848_low_11
Description: NF9848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9848_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 19 - 305
Target Start/End: Complemental strand, 53180130 - 53179844
Alignment:
| Q |
19 |
gaaatgcatacacaatacatacatagtaacaagaagttatgtgaagctcgtgaagagaaagcaaattaaattaatatagcaatatctctagttatgatca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53180130 |
gaaatgcatacacaatacatacatagtaacaagaagttatgtgaagctcgtgaagagaaagcaaattaaattaatatagcaatatctctagttatgatca |
53180031 |
T |
|
| Q |
119 |
tggcttgcatatccaatttgaactttcattggagactgttgttgtggtcttagctgggcaactttaatggctaaaggtgaccacacgcgcatgtttgaat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
53180030 |
tggcttgcatatccaatttgaactttcattggagactgttgttgtggtcttagctgggcaactttaatgcctaaaggtgaccacacacgcatgtttgaat |
53179931 |
T |
|
| Q |
219 |
aagtagttggctagaaagggactttgtctcttccaagttcccagattatggtggaacaagaactaagtaacatgcccctttgcttct |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
53179930 |
aagtagttggctagaaagggactttgtctcttccaagttcccagattatggtggaacaagaactaagtaacatgccccattgattct |
53179844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University