View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9848_low_12 (Length: 305)
Name: NF9848_low_12
Description: NF9848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9848_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 34 - 292
Target Start/End: Complemental strand, 45699840 - 45699586
Alignment:
| Q |
34 |
ggtaggtagatgcataacaaatgtatcaattctaattctaaatatggtggtacttctctatctgcccacgctatatatatattaattatctgaagtattg |
133 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45699840 |
ggtagttagatgcataacaaatgtatcaattctaattctaaatatggtggtacttctctatctgcccacgctatatatat--taattatctgaagtattg |
45699743 |
T |
|
| Q |
134 |
tgtttattattgttcttaggcaccatagattatagtaataatgataaaaagatgttgattgactgcttccaacaacctcctatatgtgtttctgctctga |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45699742 |
tgtttattattgttcttaggcaccatagattatagtaataatgataaaaagatgttgattgactgcttccaacaacctcc--tatgtgtttctgctctga |
45699645 |
T |
|
| Q |
234 |
taaaaagagacgatatattaaaattcttctcatgcttgatggatcctgcaacaagttca |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45699644 |
taaaaagagacgatatattaaaattcttctcatgcttgatggatcctgcaacaagttca |
45699586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University