View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9848_low_13 (Length: 290)
Name: NF9848_low_13
Description: NF9848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9848_low_13 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 70 - 290
Target Start/End: Original strand, 7737902 - 7738123
Alignment:
| Q |
70 |
gattcgtacgcatatatttaaattttaacacatgatcttataagatatgagtcgtgtcgtgtgcttactacatcaacatttgtttgtataatttcagttt |
169 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7737902 |
gattcgtacgcatatatctaaattttaacacatgctcttataagatatgagtcgtgtcgtgtacttactacatcaacatttgtttgtataatttcagttt |
7738001 |
T |
|
| Q |
170 |
catcaaaaagaagatggataactaataggttagtaatggc-nnnnnnnnnagaggatgataattggtcctcttcttttgccattgatattatgaagttta |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7738002 |
catcaaaaagaagatggataactaataggttaatattggcttttttttttagaggatgataattggccctcttcttttgccattgatattatgaagttta |
7738101 |
T |
|
| Q |
269 |
attctggcatgtttgctaaagt |
290 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
7738102 |
attctggcatgtttgctaaagt |
7738123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 7737857 - 7737906
Alignment:
| Q |
1 |
agaacatttattagattagtttctcgagttcaatgaaaaccacacgattc |
50 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7737857 |
agaacatttattagattagtttctcgggttcaatgaaaaccacacgattc |
7737906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University