View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9848_low_17 (Length: 259)
Name: NF9848_low_17
Description: NF9848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9848_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 4 - 249
Target Start/End: Complemental strand, 30635833 - 30635589
Alignment:
| Q |
4 |
gatggacatcattattatttttataactttctttctctnnnnnnnnnctaggaaactttgatctgaatagcaattaatcaagatcatactagactcagga |
103 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30635833 |
gatgaacaccattattatttttataactttctttctctaaaaaaaa-ctaggaaactttgatctgaacagcaattaatcaagatcatactagactcagga |
30635735 |
T |
|
| Q |
104 |
gaatattaatttcaaaatcaaactagttgcagtcgaacacatgcattatgcatgacacattttttatttaaaaatgcaatgaatcagaggctagaatata |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30635734 |
gaatattaatttcaaaatcaaactagttgcagtcgaacacatgcattatgcatgacacattttttatttaaaaatacaatgaatcagaggctagaatata |
30635635 |
T |
|
| Q |
204 |
aaaatcttatattatttactttagtcaacaattcccttgctctctg |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30635634 |
gaaatcttatattatttactttagtcaacaattcccttgctctctg |
30635589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University