View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9848_low_20 (Length: 250)
Name: NF9848_low_20
Description: NF9848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9848_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 39 - 209
Target Start/End: Original strand, 5901552 - 5901726
Alignment:
| Q |
39 |
gtcatttgacatgttatgctgatcaaatggctatgtggatgcatattttgtggatttgcagatcctaatggttagttcatttctcttatagatcaccctt |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5901552 |
gtcatttgacatgttatgctgatcaaatggctatgtggatgcatattttgtggatttgcagatcctaatggttagttcatttctcttatagatcaccctt |
5901651 |
T |
 |
| Q |
139 |
aattagtacatttttatgtaca----ttacttcaatattaatttcatcatattatatataatcgttcattatgtc |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
5901652 |
aattagtacatttttatgtacatagtttacttcaatattaatttcatcatattatatatcatcgtccattatgtc |
5901726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University