View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9849_low_10 (Length: 240)
Name: NF9849_low_10
Description: NF9849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9849_low_10 |
 |  |
|
| [»] scaffold0025 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 45406133 - 45405903
Alignment:
| Q |
1 |
ccttgggaagcttgtcttttggtggtggaccaagataaaatccttcttttatgctatcaataagcaaatgtcagcactataacaaggtgaaatttaaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45406133 |
ccttgggaagcttgtcttttggtggtggaccaagataaaatccttcttttatgctatcaataagcaaatgtcagcactataacaaggtgaaatttaaatg |
45406034 |
T |
 |
| Q |
101 |
taaacctttaagaggtagctagggactgtaacccagcaacgtaccctggaattaatgttgaggacttaaaggaaccatttcccatcaatgggccatctgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45406033 |
taaacctttaagaggtagctagggactgtaacccagcaacgtaccctggaattaatgttgaggacttaaaggaaccatttcccatcaatgggccatctgg |
45405934 |
T |
 |
| Q |
201 |
cttagagaaaaagcttaaccgtatgatgtcc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
45405933 |
cttagagaaaaagcttaaccgtatgatgtcc |
45405903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 142 - 221
Target Start/End: Complemental strand, 42677 - 42598
Alignment:
| Q |
142 |
taccctggaattaatgttgaggacttaaaggaaccatttcccatcaatgggccatctggcttagagaaaaagcttaaccg |
221 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||| ||||||||| || | ||||||||| ||||||| |
|
|
| T |
42677 |
taccctggaatcaatattgaggacttaaaggaaccatttcccatcagtgggccatcaggttgagagaaaaaatttaaccg |
42598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 42815 - 42753
Alignment:
| Q |
1 |
ccttgggaagcttgtcttttggtggtggaccaagataaaatccttcttttatgctatcaataa |
63 |
Q |
| |
|
||||||| ||||| |||||| |||||||||||| ||| ||||||||||| || |||||||||| |
|
|
| T |
42815 |
ccttgggcagcttttctttttgtggtggaccaatatataatccttctttcatactatcaataa |
42753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University