View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9849_low_12 (Length: 203)
Name: NF9849_low_12
Description: NF9849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9849_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 19 - 185
Target Start/End: Original strand, 7451159 - 7451325
Alignment:
| Q |
19 |
tggagtgattggttcatatttcgtgggggtgtgtgagccactctagtctctcaacctcgaagttagagctagacagtgatgaacaaattaagctaatgcc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7451159 |
tggagtgattggttcatatttcgtgggggtgtgtgagccactctagtctctcaacctcgaagttagagctagacagtgatgaacaaattaagctaatgcc |
7451258 |
T |
|
| Q |
119 |
cgaattgtggcgcaatttaggggttgttgaaaactagagctataggtgaagcataaagaaggaaagg |
185 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7451259 |
ccaattgtggcgcaatttaggggttgttgaaaactagagctataggtgaagcataaagaaggaaagg |
7451325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 19 - 89
Target Start/End: Original strand, 7437770 - 7437839
Alignment:
| Q |
19 |
tggagtgattggttcatatttcgtgggggtgtgtgagccactctagtctctcaacctcgaagttagagcta |
89 |
Q |
| |
|
|||| ||||||||| |||||||||||| |||||||||||||||| || |||| ||| ||||||||||||| |
|
|
| T |
7437770 |
tggattgattggtttgtatttcgtgggg-tgtgtgagccactctactccctcatccttgaagttagagcta |
7437839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University