View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9849_low_5 (Length: 268)
Name: NF9849_low_5
Description: NF9849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9849_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 6232558 - 6232308
Alignment:
| Q |
1 |
gctcttcaaacatccgtttatctccgatgttgaaactgtttcagttgtaaatgagttagttgatgagttgccattgtcttcaccttctccaaaaacttac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6232558 |
gctcttcaaacatccgtttatctccgatgttgaaactgtttcagttgtaaatgagttagttgatgagttgccattgtcttcaccttctccaaaaacttac |
6232459 |
T |
 |
| Q |
101 |
ttcaatatgctcattgtgtttcttctactcgtacgacattgcctcctatttcaaatgaattatggagtgaataaaaaataaatcactttggttcattctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6232458 |
ttcaatatgctcattgtgtttcttctactcgtacgacattgcctcctatttcaaatga---atggagtgaataaaaaataaatcactttggttcattctt |
6232362 |
T |
 |
| Q |
201 |
cttttctattaagctaggaatagtagtagatcacaggattcgttgttttgatgc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6232361 |
cttttctattaagctaggaatagtagtagatcacaggattcgttgttttgatgc |
6232308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University