View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9851_high_9 (Length: 243)
Name: NF9851_high_9
Description: NF9851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9851_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 24990456 - 24990238
Alignment:
| Q |
1 |
tttgctgatatggagcagtatatttgggtaagtacttcgactatttgattccaacaatagtttctcttaatttaactgagtagaa---attgaccttttc |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
24990456 |
tttgctgatatggagcagtatatttgggtaagtacttcgactatttgattccaacaatagtttctcttaatttaactgagcagaagaaattgacctttt- |
24990358 |
T |
|
| Q |
98 |
gtttcactattggtttttatcaggtgcttataacgatgaagaagctgccgctagagcttatgatttggctgcactcaaatactggggaacatcgacgttt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24990357 |
gtttcactattggtttttatcaggtgcttataacgatgaagaagctgccgctagagcttatgatttggctgcactcaaatactggggaacatcgacgttt |
24990258 |
T |
|
| Q |
198 |
acaaattttcctgtatgtta |
217 |
Q |
| |
|
|||||||| ||||||||||| |
|
|
| T |
24990257 |
acaaatttccctgtatgtta |
24990238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 118 - 188
Target Start/End: Complemental strand, 3271012 - 3270942
Alignment:
| Q |
118 |
caggtgcttataacgatgaagaagctgccgctagagcttatgatttggctgcactcaaatactggggaaca |
188 |
Q |
| |
|
|||| |||||| ||||||||||| | || || ||||| |||||||| |||||||| || |||||||||||| |
|
|
| T |
3271012 |
caggggcttatgacgatgaagaatcagcagccagagcatatgatttagctgcactaaagtactggggaaca |
3270942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University