View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9852_high_16 (Length: 387)
Name: NF9852_high_16
Description: NF9852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9852_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 349; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 1 - 377
Target Start/End: Original strand, 34826360 - 34826736
Alignment:
| Q |
1 |
tccgtgtcactcgtatactctttggttcttccaccttcttacctcttctaccccgcactactgtggtattggtagacttatcttcggggtggatgaagtt |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34826360 |
tccgtgtcacccgtatactctttggttcttccaccttcttacctcttctaccccgttctactgtggtattggtagacttattttcggggtggatgaagtt |
34826459 |
T |
 |
| Q |
101 |
aacaacaataacggtgacttcaccgatcttaatggtggatccatcacggagataaaaagaagtatttggaggaatgaccgcatcgtccaaagaagttgca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
34826460 |
aacaacaataacggtgacttcaccgatcttaatggtggatccatcacggagataaaaagaagtatttggaggaatgaccgcatcgtccaaagaagttcca |
34826559 |
T |
 |
| Q |
201 |
tttgatgaggaaacaaggtctctgagtgcccatttaccggattcggtatgaatagagagatgtttagtggatattccgggatccttaattggaaggttgt |
300 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34826560 |
tttgatgaggaatcaaggtctctgagtgcccatttaccggattcggtatgaatagagagatgtttagtggatattccgggatccttaattggcaggttgt |
34826659 |
T |
 |
| Q |
301 |
tgccgcagacgacacgtccaattctgatggcatatcccggtcgaaattgaagagtttcacctttacgaggacctttg |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34826660 |
tgccgcagacgacacgtccaattctgatggcatatcccggtcgaaattgaagagtttcacctttacgaggacctttg |
34826736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 117 - 174
Target Start/End: Original strand, 34824121 - 34824178
Alignment:
| Q |
117 |
acttcaccgatcttaatggtggatccatcacggagataaaaagaagtatttggaggaa |
174 |
Q |
| |
|
||||||||||||||||||||||| ||||| | ||||| ||||| |||||||||||||| |
|
|
| T |
34824121 |
acttcaccgatcttaatggtggaaccatcgctgagatgaaaaggagtatttggaggaa |
34824178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 117 - 174
Target Start/End: Original strand, 28946758 - 28946815
Alignment:
| Q |
117 |
acttcaccgatcttaatggtggatccatcacggagataaaaagaagtatttggaggaa |
174 |
Q |
| |
|
||||||||||||||||||||||| ||||| | ||||| ||||| |||||| ||||||| |
|
|
| T |
28946758 |
acttcaccgatcttaatggtggaaccatcgcagagatgaaaaggagtattcggaggaa |
28946815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University