View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9852_low_29 (Length: 282)
Name: NF9852_low_29
Description: NF9852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9852_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 22 - 271
Target Start/End: Original strand, 40856959 - 40857208
Alignment:
| Q |
22 |
cccctccctaggcgaccaggtggtgacaaaatttatatagttttcgattatcagcttcctgctgcattgagaaagattccactggaccgtcatttatcgc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40856959 |
cccctccctaggcgaccaggtggtgacaaaatttatatagttttcgattatcagcttcctgctgcattgagaaagattccactggaccgtcatttatcgc |
40857058 |
T |
 |
| Q |
122 |
tgcaaaatgtgagaaacgttatttctgaggcagatggataccaacctcatctaattgctcccgagcaaggttaccgacgcctcctagagagctcactcaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40857059 |
tgcaaaatgtgagaaacgttatttctgaggcagatggataccaacctcatctaattgctcccgagcaaggttaccgacgcctcctagagagctcactcaa |
40857158 |
T |
 |
| Q |
222 |
ttattttaaaggccccgctcaagcatctgtagatgctgtaagtgattcat |
271 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40857159 |
ttattttaaaggtcccgctcaagcatctgtagatgctgtaagtgattcat |
40857208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University