View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9852_low_41 (Length: 239)

Name: NF9852_low_41
Description: NF9852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9852_low_41
NF9852_low_41
[»] chr1 (1 HSPs)
chr1 (40-224)||(37355176-37355360)


Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 40 - 224
Target Start/End: Original strand, 37355176 - 37355360
Alignment:
40 aatttgaggatgatgaaacaatctgtggtggagtaattcagcaggagttggatgtcattttcaagagttttggttggccaatactctatcagatcgggga 139  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37355176 aatttgaggatgatgaaacaatctgtggtggagtaattcagcaggagttggatgtcattttcaagagttttggttggccaatactctatcagatcgggga 37355275  T
140 cataaaaccacagcatggagcccatggtttggaagcatccagttaaggggatttttgtaatgcagagtatctatctcaattatgt 224  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37355276 cataaaaccacagcatggagcccatggtttggaagcatccagttaaggggatttttgtaatgcagagtatctatctcaattatgt 37355360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University