View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9852_low_44 (Length: 216)
Name: NF9852_low_44
Description: NF9852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9852_low_44 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 29 - 204
Target Start/End: Original strand, 30923485 - 30923659
Alignment:
| Q |
29 |
aacataattgagaatattcattacacgtgttattgctacagaggttttgaagctattgggtttggttttgtagaaggagcttttggatcctgcaattaaa |
128 |
Q |
| |
|
||||||||||||||| | ||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30923485 |
aacataattgagaatgt-cattacatgtgttagtgctacagaggttttgaagctattgggtttggttttgtagaaggagcttttggatcctgcaattaaa |
30923583 |
T |
|
| Q |
129 |
gggactttgaatgtgcttactgcggcgaaggaagtaggggtgaagcgagtggttgttacttcttctatctctgcta |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30923584 |
gggactttgaatgtgcttactgcggcgaaggaagtaggggtgaagcgagtggttgttacttcttctatctctgcta |
30923659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University