View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9852_low_46 (Length: 209)
Name: NF9852_low_46
Description: NF9852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9852_low_46 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 86 - 190
Target Start/End: Complemental strand, 31442826 - 31442722
Alignment:
| Q |
86 |
ctcaacttatttatgatatgaaactgtctataattaatgtaattttaattttaagattattataacaagatgaagagaaattgaatatttttaaaccctt |
185 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||| |||||||||||||||||||||||||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
31442826 |
ctcaacttatttatgatatgaaattgtctatgattaacgtaattttaattttaagattattataacaagatgaaaacaaattgaatatttttaagccctt |
31442727 |
T |
|
| Q |
186 |
caaag |
190 |
Q |
| |
|
||||| |
|
|
| T |
31442726 |
caaag |
31442722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 13 - 71
Target Start/End: Complemental strand, 31443223 - 31443165
Alignment:
| Q |
13 |
ggagcagagagaatggaaaagctttggaggagatcaaggagacgagagataaagggccc |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
31443223 |
ggagcagagagaatggaaaagctttggaggagatcaaagagatgagagataaagggccc |
31443165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University