View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9852_low_46 (Length: 209)

Name: NF9852_low_46
Description: NF9852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9852_low_46
NF9852_low_46
[»] chr7 (2 HSPs)
chr7 (86-190)||(31442722-31442826)
chr7 (13-71)||(31443165-31443223)


Alignment Details
Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 86 - 190
Target Start/End: Complemental strand, 31442826 - 31442722
Alignment:
86 ctcaacttatttatgatatgaaactgtctataattaatgtaattttaattttaagattattataacaagatgaagagaaattgaatatttttaaaccctt 185  Q
    ||||||||||||||||||||||| ||||||| ||||| |||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |||||    
31442826 ctcaacttatttatgatatgaaattgtctatgattaacgtaattttaattttaagattattataacaagatgaaaacaaattgaatatttttaagccctt 31442727  T
186 caaag 190  Q
    |||||    
31442726 caaag 31442722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 13 - 71
Target Start/End: Complemental strand, 31443223 - 31443165
Alignment:
13 ggagcagagagaatggaaaagctttggaggagatcaaggagacgagagataaagggccc 71  Q
    ||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||    
31443223 ggagcagagagaatggaaaagctttggaggagatcaaagagatgagagataaagggccc 31443165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University