View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9853_high_15 (Length: 261)
Name: NF9853_high_15
Description: NF9853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9853_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 253
Target Start/End: Original strand, 45528030 - 45528265
Alignment:
| Q |
18 |
taaactctctctccttcgttgttgtcgtaactttcgccactttcttcttagtccttcttttctatttccgatgtatcacgttcttaaaactctacatggc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45528030 |
taaactctctctccttcgttgttgtcgtaactttcgccactttcttcttagtccttcttttctatttccgatgtatcacgttcttaaaactctacatggc |
45528129 |
T |
 |
| Q |
118 |
tttttcttcctttgttgtattaggttttcttggaggtgaaatttcgannnnnnngattcaacattttagtgttccggttgattgtataacgtttttggtt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45528130 |
tttttcttcctttgttgtattaggttttcttggaggtgaaatttcgatttttttgattcaacattttagtgttccggttgattgtataacgtttttggtt |
45528229 |
T |
 |
| Q |
218 |
gttttgtgtaattttgctgttgttggtgtctgtgct |
253 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45528230 |
gttttgtgtaattttgctgttgttggtgtttgtgct |
45528265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University